Banner trang chủ
Thứ Năm, ngày 19/05/2022

Study on psbA-trnH DNA barcoding characteristics in some species of polyscias genus

20/05/2021

    Polyscias is a flowering genus that belongs to the Araliaceae family, which is commonly used for medical purposes and widely distributed over the world for its economic value due to the rich contents of phytochemical. DNA barcode is a robust method to identify species and evaluate phylogenetic relationships. In this study, the psbA-trnH region was used to investigate the relationship of five species of Polyscias genus. The sequencing results showed that the psbA-trnH sequence has about 500 nucleotides as expected length. Raw data has been analyzed and these sequences were compared to six reference sequences from NCBI. The phylogenetic tree of Polyscias genus-based psbA-trnH sequences with Tetraplasandra hawaiensis as out-group species was conducted by bioinformatic tools. The combination between the genetic distance method and Maximum likelihood proposed high confidence results. All five studied samples: P. balfouriana (LT), P. serrata Balf (LR), P. fruticosa (LN), P. scutellaria (LD), P. filicifolia (LTO) were grouped into same clade, which had a close relationship with P. sp. Wen 10765 and P. austranliana with reliable bootstrap supported (BS: 72). The psba-trnH region has been suggests as a case study inDNA barcoding researches. Thus, it would be considered widely used in further classification studies.

 Introduction

    DNA barcoding is a modern biological tool for accurate, rapid, and automatable species identification and phylogenetic reconstruction using only a standardized piece of DNA sequence. Regions are selected to be barcode is required to universally present in target lineages and have adequate sequence variation to discriminate among species (Hebert et al., 2003).

    The short DNA sequence from a standard region of the genome is known as a marker which is different for various species. For example, the most commonly used marker for an animal is Cytochrome C Oxidase 1 (COI), found in mtDNA. Another suitable marker for fungi is the Internal Transcribed Spacer (ITS) rDNA. Chloroplast DNA barcodes as matK, psbA-trnH, rbcL are used in plants (Kaur, 2015).

    Polyscias is a genus of the Araliaceae family. This genus is widely distributed over the world for economic value and is commonly used for medical purposes due to its rich contents of phytochemical. Some Polyscias species are not only functional but also ornamental. Polyscias is named as two Greek words: “poly” means many and “skia” means shade, which indicates the thick foliage characteristic of this genus (Ashmawy et al., 2018). According to the investigation of Vietnamese Ginseng Center in Southern provinces, Polyscias has 6 species: Polyscias fruticosa (L) Harm, Polyscias balfouriana Bailey, Polyscias filicifoli (Merr et Fourn w) Bailey, Polyscias guilfeylei var lacinita Bailey, Polyscias guilfeylei (Cogn et Marche) Bail, Polyscias scutellarie (N.L.Burn) Fosberg (Nguyen Thượng Dong et al., 2007).

    In the paper, we focused on studying on psbA-trnH DNA barcode to investigate the diversity of five species of Polyscias.

Materials and methods

Plant materials

   Five leaf specimens of the Polyscias genus were collected at the Department of Agronomy, Vietnam National University of Agriculture (Table 1).

Table 1: Information about studied samples

No.

Code

Scientific Name

Vietnamese name

1

LT

Polyscias balfouriana

Dinh lang la tron

2

LTO

Polyscias filicifolia

Dinh lang la to

3

LN

Polyscias fruticosa

Dinh lang la nho

4

LD

Polyscias scutellaria

Dinh lang la dia

5

LR

Polyscias serrata Balf

Dinh lang la rang

DNA extraction, amplification, purification and sequencing

    Total DNA was extracted from fresh leaves follow the extraction procedure by CTAB (Doyle et al Doyle, 1990).

    Specific primers Pu_psbA-trnH were designed to amplify psbA-trnH genes of five Polyscias samples based on the reference sequences on Genbank (Table 2).

Table 2: List of the psbA-trnH primer used in the study

Primer

DNA region

Sequence (5’ - 3’)

Amplification size (kb)

Pu_psbA-trnHF

psbA-trnH

GTTATGCATGAACGTAATGCTC

0.5kb

Pu_psbA-trnHR

ATGGTGGATTCACAATCC

    The condition of amplification was optimized for 25 µl of PCR, including 50 ng extracted DNA, 2.5 µM of each primer, 0.75 unit of Phusion polymerase (Thermo Scientific), 1 mM of each dNTP and Phusion PCR buffer. The amplification thermal cycles were performed as follows: A cycle of denaturing at 95oC for 4 minutes, 35 cycles of amplification including 95oC/30s followed by annealing at 58oC/30s (trnL-trnF and rbcL) and extension 72oC/1 min 30s; ending with a final extension step of 72oC/5 mins. The PCR products were checked by electrophoresis on 0.8% agarose gel. Successful PCR products were purified by Thermo Scientific GeneJET Gel Extraction Kit. psbA-trnH fragments were sequenced by the Sanger Sequence method. Sequencing was carried out using the BigDyeTM terminator v 3.1 cycle sequencing kit (Applied Biosystems) in a final volume of 20 µl. The sequencing was performed on an ABI 3500 genetic analyzer following Sanger’s principle.

Results and discussion

DNA extraction

    In this study, the genomic DNA of five Polyscias leaf samples (LT, LTO, LN, LD, LR) were isolated using the CTAB extraction protocol. By using extraction buffer (as described above) combined with removing protein and impurities with a mixture of Chloroform: isoamyl alcohol (24:1) solution, precipitation with CH3COONa 3M and EtOH 100%, RNase added, total DNA was collected.  Figure 1 indicated that DNA bands were clear, not smeary; however, DNA genomic was still contaminated.

   Then, optical density (OD) measurement was performed using Nanodrop Spectrophotometers to determine the concentration of DNA and retest the purity of total DNA. The results showed that samples had DNA concentration ranges from 108.549 to 757.212 ng/µl. the LN sample had the highest DNA concentration and the LT sample had the lowest DNA concentration (Table 3). However, all five DNA samples were enough concentration for the next steps. The LD, the LTO, the LT samples had values of A260/A280 in the ranges of 1.8-2.0, this means that contaminations were removed from genomic DNA. A260/280 of the LN sample was 1.705, this value demonstrates that the DNA sample was contaminated with a protein. DNA sample of the LN had OD value 2.018, DNA was contaminated with RNA. However, the concentration of DNA samples was enough, and these samples were quality enough to be used for the next steps in our study.

Table 3: OD values of five Polyscias samples

Sample Name

Nucleic Acid (ng/uL)

A260/A280

A260

A280

P. fruticosa (LN)

757.212

1.705

15.14

8.884

P.  scutellaria (LD)

424.499

1.94

8.49

4.376

P.  serrate Balf (LR)

295.159

2.018

5.903

2.925

P.  filicifolia (LTO)

178.971

1.859

3.579

1.925

P.  balfouriana (LT)

108.549

1.917

2.171

1.133

P.  balfouriana (LT)

108.549

1.917

2.171

1.133

PCR amplification of psbA-trnH fragment

    The total DNA of five Polyscias leaves was enough quality for PCR reaction. In this study, the psbA-trnH primer was used to multiply the genes of 5 samples of the Polyscias genus. The psbA-trnH is one of the most rapidly evolving spacers in chloroplast DNA and this region demonstrated good universality and high amplification success (Shaw et al., 2005; Yao et al., 2009). Primers Pu_psbA-trnH for amplification of target regions were designed with PCR expected length of about 0.5kb.

    For DNA templates, the amount of DNA used for PCR needs to be adjusted accordingly. The PCR efficiency can be reduced if the concentration of DNA templates is too high. During the reaction, we adjusted the primer concentration, as well as the DNA concentration to find the optimal amounts. The annealing temperature was also tested at different temperature ranges and the optimal temperature was 58oC.  The suitable thermal cycle is very important in PCR reaction because it ensures good torsion of the DNA molecules as well as exact priming and chain elongation. After optimization, we found the optimal thermal cycle for PCR reaction including 30 cycles.

    When PCR reaction ended, PCR products were loaded in 0.8% agarose gel and compared to 1kb standard marker. Electrophoresis results showed that there were two bands but a DNA band of about 0.5kb was the most specific and bright in all five samples (Figure 2). Therefore, the pair of psbA-trnH primers multiplied psbA-trnH gene fragments as expected length. We could conclude that primers psbA-trnH were used to success amplification desired gene segments from the DNA of 5 plant samples belonging to the Polyscias genus.

    Next, PCR products were purified to prepare for DNA sequencing. We used the purification procedure of the Thermo Scientific GeneJET Gel Extraction Kit to collect specific DNA bands (0.5kb). This method ensured the purity of products (Figure 3). All DNA bands were bright and specific. Thus, the quality of DNA was well enough for sequencing.

DNA sequecing

    The nucleotide sequences of the psbA-trnH fragment of five Polyscias samples were identified. Results showed that all five samples were well-sequenced and had the length of psbA-trnH gene about 500 nucleotides. Therefore, the psbA-trnH segments were amplified accurately.

    The raw sequences were edited using Chromas to remove noise signals at the beginning and the end. Finally, each sequence had 457 nucleotides and GC contents were about 30%, a typical characteristic for noncoding regions of the chloroplast genome (Degjareva et al., 2012).  These sequences were compared to available sequences collected from GenBank, NCBI (Table 4).

Table 4: Reference sequences list 

No.

GenBank Accession

number

Reference species

1

JX106123.1

Polyscias australiana

2

JX106126.1

Polyscias sp.  Wen 10765

3

JX106105.1

Polyscias macrocarpa

4

JX106124.1

Polyscias nodosa

5

JX106125.1

Polyscias schultzei

6

MH826635.1

Polyscias spectabilis

7

JX106143

Tetraplasandra hawaiensis

    Comparisons were performed by ClustalW Multiple alignments of Bioedit software. This analysis involved 11 psbA-trnH sequences: five sequences from the samples, six reference sequences (Table 4). References were psbA-trnH sequences of species belonging to the Polyscias genus. These sequences were published on NCBI.

    Species selected to be out-group which is species belonging to other genus or other family but they must have relative similarity with the references and studied sequences. In this study, we selected Tetraplasandra hawaiensis of Tetraplasandra genus (Araliaceae family) as out-group species.

    In the Polyscias genus, the non-coding psbA-trnH intergenic spacer is located from nucleotides 19 to 429. This spacer is located between the psbA gene and the gene of histidine transfer RNA (trnH), which plays an important role in the regulation of the expression of these genes. Degtjareva et al. (2012) has been proposed psbA-trnH region as suitable for DNA barcoding studies.

    The polymorphism sites of 11 sequences were observed in Table 5, the results showed that psbA-trnH regions of five studied sequences from our samples were the most similar to P. australiana, followed by P.  sp.  Wen 10765. Studied sequences had the greatest difference with P. nodosa.

Table 5a: The polymorphism sites of gene psbA-trnH of 11 Polyscias species

Species

Polymorphism sites

 

52

53

54

55

56

136

138

139

140

141

143

144

147

148

P.  balfouriana (LT)

T

C

T

T

-

-

A

G

T

T

C

T

A

A

P.  filicifolia (LTO)

T

-

T

T

G

-

A

G

T

T

C

T

A

A

P.  fruticosa (LN)

T

T

T

G

-

-

A

G

T

T

C

T

A

A

P.  scutellaria (LD)

-

-

T

T

G

-

A

G

T

T

C

T

A

A

P.  serrata Balf (LR)

T

T

T

T

G

-

A

G

T

T

C

T

A

A

P. australiana

T

-

T

-

G

-

A

G

T

T

C

T

A

A

P.  sp.  Wen 10765

T

-

T

T

G

-

A

G

T

T

C

T

A

A

P.  macrocarpa     

T

-

-

-

G

C

T

A

C

C

A

G

T

C

P.  nodosa           

G

-

-

-

A

C

T

A

C

C

A

G

T

C

P.  schultzei       

T

-

-

-

G

C

T

A

C

C

A

G

T

C

P.  spectabilis      

G

-

-

A

A

C

T

A

C

C

A

G

T

C

Table 5b: The polymorphism sites of gene psbA-trnH of 11 Polyscias species (continued)

Species

Polymorphism sites

 

149

150

156

157

158

169

287

295

296

356

424

432

452

459

P.  balfouriana (LT)

A

C

T

T

A

G

A

T

G

A

A

A

G

G

P.  filicifolia (LTO)

A

C

T

T

A

G

A

T

G

A

A

A

T

A

P.  fruticosa (LN)

A

C

T

T

A

G

G

T

G

A

G

A

G

A

P.  scutellaria (LD)

A

C

T

T

A

G

G

T

G

A

G

A

T

A

P.  serrata Balf (LR)

A

C

T

T

A

G

G

T

G

A

A

A

T

A

P. australiana

A

C

T

T

A

G

G

T

G

A

A

A

T

A

P.  sp.  Wen 10765

A

C

T

T

A

G

G

T

G

A

G

A

T

A

P.  macrocarpa        

T

T

A

A

G

C

G

G

A

G

G

G

T

A

P.  nodosa            

T

T

A

A

G

C

G

G

A

A

-

G

T

A

P.  schultzei         

T

T

A

A

G

C

T

G

A

G

G

G

T

A

P.  spectabilis       

T

T

A

A

G

C

G

T

A

G

G

G

T

T

Genetic distance and phylogenetic tree

    Genetic distances were calculated automatically by the pairwise distance method in MEGAX software. The pairwise distance method is an evaluation of the differences between pairs of sequences and then these differences transform into a distance. These distances were used to estimate a tree.

   The results compared the differences between the pairs of sequences according to Kimura 2 model Parameter (Kimura, 1980) indicated that the ranges of genetic difference were from 0.00661 to 0.08506  in which the lowest genetic difference was 0.00661 of P. filicifolia (LTO) and P. australiana. Therefore, two species could have a close relationship. 0.00663 was the difference between P. australiana and P. sp. Wen 10765. The genetic difference was 0.00883 found in P. fruticosa (LN) and P.  scutellaria (LD); P. fruticosa (LN) and P.  serrate Balf (LR); P. fruticosa (LN) and P. sp. Wen 10765. Thus, P. fruticosa (LN) could be grouped into a group with P.  scutellaria (LD), P.  serrate Balf (LR) and P. sp. Wen 10765. The difference between P. nodosa and P. balfouriana (LT) was 0.08506 showed the highest difference. 

    A phylogenetic tree of 12 sequences was constructed using the Maximum-Likelihood (ML) methods based on the Hasegawa-Kishiho-Yano model in MEGAX. ML method is one of the most widely used for phylogenetic tree reconstruction. When 1000 bootstrap replicated of the data ran, bootstrap support values for singular clades had been computed. These values indicate how many times out of 100 the same branch was observed when repeating the phylogenetic reconstruction on a re-sampled set of data.

    In this study, the tree diagram constructed with psbA-trnH data using the Maximum-Likelihood method indicated that there were two classifications. All five examined species: P. balfouriana (LT), P. serrata Balf (LR), P. fruticosa (LN), P. scutellaria (LD), P. filicifolia (LTO) were grouped in Clade I, which had a close relationship with P. sp. Wen 10765 and P. australiana with well supported (BS:76). Clade II included two reference species (P.  macrocarpa and P. schultzei) with strongly supported (BS:96). P. nodasa and P. spectabilis had a quite distant relationship with studied species. In Clade I, P. balfouriana (LT) and P. serrata Balf (LR) were sister groups- two descends that split from the same node with weak supported (BS:32), P.  filicifolia (LTO) and P. australiana were sister groups (BS=65) (Figure 5).

    Thus, chloroplast intergenic psbA-trnH spacer has recently become a popular tool for plant identification and phylogenetic analyses. This region has been proposed as suitable for DNA barcoding studies. Since the psbA-trnH is one of the most rapidly evolving spacers in chloroplast DNA with 75 bp conserved fragments at the ends. Besides, it demonstrated good universality and high amplification success (Degtjareva et al., 2012). Therefore, psbA-trnH gene should be widely used for further plant phylogenetic analyses in the world in general and Việt Nam in particular.

Conclusions

    The five psbA-trnH fragments from samples of five leaves of Polyscias genus were determined in the nucleotide sequence with the length of 457 nucleotides. By using Bioedit, BLAST, and MEGAX software, the sequences were analyzed and constructed phylogenetic trees of Polyscias species based on psbA-trnH fragment. From the research, five psbA-trnH sequences of the five species were grouped in Clade I and shown the relationship among the five Polyscias with six reference sequences. The DNA barcoding that we researched on the paper would contribute to the further phylogenetic of medicinal plants of Việt Nam and research on valuable plant gene conservation in Việt Nam.

Huỳnh Thị Thu Huệ

Institute of Genome Research, Vietnam Academy of Science and Technology

Nguyễn Lê Trà My, Trần Thị Hồng Hạnh

Vietnam National University of Agriculture

Phạm Thị Kiều Oanh

Department of Science, Technology and International Cooperation, Vietnam Environment Administration

(Source: Vietnam Environment Administration Magazine, English Edition I - 2021)

References

[1]. Ashmawy, N. S., Gad, H. A., Ashour, M. L., El-Ahmady, S. H., and Singab, A. N. B. (2020). The genus Polyscias (Araliaceae): A phytochemical and biological review. Journal of Herbal Medicine, 23, 100377.

[2]. Degtjareva, G. V., Logacheva, M. D., Samigullin, T. H., Terentieva, E. I., and Valiejo-Roman, C. M. (2012). Organization of chloroplast psbA-trnH intergenic spacer in dicotyledonous angiosperms of the family Umbelliferae. Biochemistry (Moscow), 77(9): 1056–1064.

[3]. Hebert, P. D. N., Cywinska, A., Ball, S. L., and deWaard, J. R. (2003). Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences, 270(1512): 313–321.

[4]. Kaur, S. (2015). DNA Barcoding and Its Applications. International Journal of Engineering Research and General Science, 3(2): 602-604.

[5]. Nguyễn Thượng Dong, Trần Công Luận, và Nguyễn Thị Thu Hương, 2007. Sâm Việt Nam và một số cây thuốc họ Nhân sâm. NXB khoa học và kỹ thuật Hà Nội, tr. 293.

[6]. Nithaniyal, S., and Parani, M. (2016). Evaluation of chloroplast and nuclear     DNA barcodes for species identification in Terminalia L. Biochemical Systematics and Ecology 68: 223-229.

[7]. Yao, H., Song, J., Ma, X., Liu, C., Ying Li. (2009). Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region. Planta Med. 75(6): 667-9.

Ý kiến của bạn